Bepirovirsen (sodium)
HY-147217A
Product group Molecular Biology
Overview
- SupplierMedChem Express
- Product NameBepirovirsen (sodium)
- Delivery Days Customer14
- CertificationResearch Use Only
- Scientific DescriptionBepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3].
- Storage Instruction-20°C
- UNSPSC41106300