Flow cytometry analysis of BCMA expression in RPMI-8226 cells transduced with BCMA CRISPR/Cas9 lentivirus
Flow cytometry analysis of BCMA expression in RPMI-8226 cells transduced with BCMA CRISPR/Cas9 lentivirus
BCMA CRISPR/Cas9 Lentivirus (Integrating)
78893
Product group Expression
Overview
- SupplierBPS Bioscience
- Product NameBCMA CRISPR/Cas9 Lentivirus (Integrating)
- Delivery Days Customer7
- CertificationResearch Use Only
- Scientific DescriptionThe BCMA CRISPR/Ca9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and 5 sgRNA (single guide RNA) targeting human BCMA (B-cell maturation antigen) driven by a U6 promoter (see Table 1 for sgRNA sequences). The integrating lentivirus integrates randomly into the cells genome to express both the Cas9 and sgRNAs. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. List of sgRNA sequences in the BCMA CRISPR/Cas9 Lentivirus. Gene Target: Primer ID: sgRNA Sequence: TNFRSF17 (BCMA) TNFRSF17-1 CCTCTAACATGTCAGCGTTA TNFRSF17 (BCMA) TNFRSF17-2 TGTCAACTTCGATGTTCTTC TNFRSF17 (BCMA) TNFRSF17-3 CGAGTACACGGTGGAAGAAT TNFRSF17 (BCMA) TNFRSF17-4 TTCACTGAATTGGTCACACC TNFRSF17 (BCMA) TNFRSF17-5 GTGTTTTTAAACTCGTCCTT Note: BPS Bioscience also offers a non-integrating version of this product (BPS Bioscience #78894).
- Storage Instruction-80°C
- UNSPSC41106621
