
Flow cytometry analysis of BCMA expression in RPMI-8226 cells transduced with BCMA CRISPR/Cas9 lentivirus.
BCMA CRISPR/Cas9 Lentivirus (Non-Integrating)
78894
Product group Molecular Biology
Overview
- SupplierBPS Bioscience
- Product NameBCMA CRISPR/Cas9 Lentivirus (Non-Integrating)
- Delivery Days Customer7
- CertificationResearch Use Only
- Gene ID608
- Target nameTNFRSF17
- Target descriptionTNF receptor superfamily member 17
- Target synonymsBCM, BCMA, CD269, TNFRSF13A, tumor necrosis factor receptor superfamily member 17, B cell maturation antigen, B-cell maturation factor, B-cell maturation protein
- Hazard Informationun3373
- Protein IDQ02223
- Protein NameTumor necrosis factor receptor superfamily member 17
- Scientific DescriptionThe BCMA CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and with 5 sgRNA (single guide RNA) targeting human BCMA (B- cell maturation antigen) driven by a U6 promoter. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. The non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, Cas9 is not permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cells genome. Despite transient expression of Cas9 and sgRNA, knockout cell lines can still be generated using cell sorting or limiting dilution due to the permanent changes in the genomic DNA from the Cas9 nuclease activity and NHEJ repair. Table 1: List of sgRNA Sequences in the BCMA CRISPR/Cas9 Lentivirus. Target: TNFRSF17 (BCMA) Primer ID: sgRNA Sequence: TNFRSF17-1 CCTCTAACATGTCAGCGTTA TNFRSF17-2 TGTCAACTTCGATGTTCTTC TNFRSF17-3 CGAGTACACGGTGGAAGAAT TNFRSF17-4 TTCACTGAATTGGTCACACC TNFRSF17-5 GTGTTTTTAAACTCGTCCTT Note: Puromycin selection should not be used for more than 48 hours post-transduction, which may lower knockout efficiency.
- Storage Instruction-80°C
- UNSPSC41115812
- SpeciesHuman




