Bepirovirsen [1403787-62-1]
HY-147217
Product group Molecular Biology
Overview
- SupplierMedChem Express
- Product NameBepirovirsen [1403787-62-1]
- Delivery Days Customer10
- CAS Number1403787-62-1
- CertificationResearch Use Only
- Estimated Purity98.44
- Molecular FormulaC230H309N88O115P19S19
- Molecular Weight7344.00
- Scientific DescriptionBepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
- SMILES[Bepirovirsen]
- Storage Instruction-20°C
- UNSPSC41115811