CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
K010
ApplicationsOther Application
Product group Expression
Overview
- SupplierApplied Biological Materials
- Product NameCRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
- Delivery Days Customer9
- ApplicationsOther Application
- Category SupplierVector and Virus
- CertificationResearch Use Only
- Scientific DescriptionControl CRISPR Lentiviral Vector with scrambled sgRNA and spCas9. Target Sequence: GCACTCACATCGCTACATCA
- Storage Instruction-20°C
- UNSPSC41106621