Bio-Connect
Flow cytometry analysis of BCMA expression in RPMI-8226 cells transduced with BCMA CRISPR/Cas9 lentivirus
Flow cytometry analysis of BCMA expression in RPMI-8226 cells transduced with BCMA CRISPR/Cas9 lentivirus
Flow cytometry analysis of BCMA expression in RPMI-8226 cells transduced with BCMA CRISPR/Cas9 lentivirus

BCMA CRISPR/Cas9 Lentivirus (Integrating)

Research Use Only
78893
BPS Bioscience
Product group Expression
Price on request
Packing Size
Large volume orders?
Order with a bulk request

Overview

  • Supplier
    BPS Bioscience
  • Product Name
    BCMA CRISPR/Cas9 Lentivirus (Integrating)
  • Delivery Days Customer
    7
  • Certification
    Research Use Only
  • Scientific Description
    The BCMA CRISPR/Ca9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and 5 sgRNA (single guide RNA) targeting human BCMA (B-cell maturation antigen) driven by a U6 promoter (see Table 1 for sgRNA sequences). The integrating lentivirus integrates randomly into the cells genome to express both the Cas9 and sgRNAs. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. List of sgRNA sequences in the BCMA CRISPR/Cas9 Lentivirus. Gene Target: Primer ID: sgRNA Sequence: TNFRSF17 (BCMA) TNFRSF17-1 CCTCTAACATGTCAGCGTTA TNFRSF17 (BCMA) TNFRSF17-2 TGTCAACTTCGATGTTCTTC TNFRSF17 (BCMA) TNFRSF17-3 CGAGTACACGGTGGAAGAAT TNFRSF17 (BCMA) TNFRSF17-4 TTCACTGAATTGGTCACACC TNFRSF17 (BCMA) TNFRSF17-5 GTGTTTTTAAACTCGTCCTT Note: BPS Bioscience also offers a non-integrating version of this product (BPS Bioscience #78894).
  • Storage Instruction
    -80°C
  • UNSPSC
    41106618

Related products

PD-1 CRISPR/Cas9 Lentivirus (Integrating)
Product group Expression
BPS Bioscience
  • SizePrice
LAG3 CRISPR/Cas9 Lentivirus (Integrating)
Product group Expression
BPS Bioscience
  • SizePrice
TCR CRISPR/Cas9 Lentivirus (Integrating)
Product group Expression
BPS Bioscience
  • SizePrice
TIGIT CRISPR/Cas9 Lentivirus (Integrating)
Product group Expression
BPS Bioscience
  • SizePrice