Inactive ASO (in vivo) sodium

HY-153734

Product group Molecular Biology
Overview
- SupplierMedChem Express
- Product NameInactive ASO (in vivo) sodium
- Delivery Days Customer10
- CertificationResearch Use Only
- Estimated Purity92.18
- Scientific DescriptionInactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5 methylcytosine. See References for the location of chemical modifications
- SMILES[CCTATAGGACTATCCAGGAA]
- Storage Instruction-20°C
- UNSPSC41106300