Inactive ASO (in vivo) sodium

MedChem Express

Inactive ASO (in vivo) sodium

10

Research Use Only

92.18

Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5 methylcytosine. See References for the location of chemical modifications

[CCTATAGGACTATCCAGGAA]

-20°C

41106300