
NLRP3 expression levels in THP-1 cells after transduction with NRLP3 Human shRNA Lentiviruses.
NLRP3 Human shRNA Lentivirus
82122

Product group Molecular Biology
Overview
- SupplierBPS Bioscience
- Product NameNLRP3 Human shRNA Lentivirus
- Delivery Days Customer7
- CertificationResearch Use Only
- Scientific DescriptionThe NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown. List of shRNA sequences present in the NLRP3 shRNA Lentivirus. Gene Target NLRP3 GAGACTCAGGAGTCGCAATTT NLRP3 GGCTGTAACATTCGGAGATTG NLRP3 TCATCATTCCCGCTATCTTTC
- Storage Instruction-80°C
- UNSPSC41106621