Bio-Connect
NLRP3 expression levels in THP-1 cells after transduction with NRLP3 Human shRNA Lentiviruses.
NLRP3 expression levels in THP-1 cells after transduction with NRLP3 Human shRNA Lentiviruses.
NLRP3 expression levels in THP-1 cells after transduction with NRLP3 Human shRNA Lentiviruses.

NLRP3 Human shRNA Lentivirus

82122
BPS Bioscience
Product group Molecular Biology
Sign in to order and to see your custom pricing.
Large volume orders?
Order with a bulk request

Overview

  • Supplier
    BPS Bioscience
  • Product Name
    NLRP3 Human shRNA Lentivirus
  • Delivery Days Customer
    7
  • Certification
    Research Use Only
  • Scientific Description
    The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown. List of shRNA sequences present in the NLRP3 shRNA Lentivirus. Gene Target NLRP3 GAGACTCAGGAGTCGCAATTT NLRP3 GGCTGTAACATTCGGAGATTG NLRP3 TCATCATTCCCGCTATCTTTC
  • Storage Instruction
    -80°C
  • UNSPSC
    41106621

Related products

NLRP3 CRISPR/Cas9 Lentivirus (Integrating)
Product group Molecular Biology
BPS Bioscience
  • SizePrice
NLRP3 CRISPR/Cas9 Lentivirus (Non-Integrating)
Product group Molecular Biology
BPS Bioscience
  • SizePrice