Tau ASO-12 (murine) (sodium)
HY-132582A
Product group Molecular Biology
Overview
- SupplierMedChem Express
- Product NameTau ASO-12 (murine) (sodium)
- Delivery Days Customer14
- CertificationResearch Use Only
- Estimated Purity97.18
- Molecular Weight7619.00
- Scientific DescriptionTauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence - 5 GCTTTTACTGACCATGCGAG 3 [1])
- SMILES[Tau ASO-12 (murine) (sodium)]
- Storage Instruction2°C to 8°C
- UNSPSC41115811